recombinant dna lrg2 1 addgene 108098 sffv cas9 2a mcherry addgene 251397 sffv krab dcas9 2a mcherry (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
recombinant dna lrg2 1 addgene 108098 sffv cas9 2a mcherry addgene 251397 sffv krab dcas9 2a mcherry
Recombinant Dna Lrg2 1 Addgene 108098 Sffv Cas9 2a Mcherry Addgene 251397 Sffv Krab Dcas9 2a Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plx303/pLX303-ZIM3-KRAB-dCas9+(Plasmid+%23154472)/pm41759529-293-174-177
Average 95 stars, based on 32 article reviews
Recombinant Dna Lrg2 1 Addgene 108098 Sffv Cas9 2a Mcherry Addgene 251397 Sffv Krab Dcas9 2a Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plx303/pLX303-ZIM3-KRAB-dCas9+(Plasmid+%23154472)/pm41759529-293-174-177
Average 95 stars, based on 32 article reviews
recombinant dna lrg2 1 addgene 108098 sffv cas9 2a mcherry addgene 251397 sffv krab dcas9 2a mcherry - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: <scp>DeSUMOylating</scp> isopeptidase 1 participates in the faithful chromosome segregation and vincristine sensitivity Article Snippet: See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense 4 of 21 | IKEDA et al. n2t. net/ addge ne: 17357 ; RRID:Addgene_17357)31], was ligated into the SalI–XbaI sites of the pENTR4- no- ccDB. .. The genes in the entry vectors were subcloned into the gateway destination vectors, pLIX402 [a gift from David Root (Addgene plasmid #41394; http:// n2t. net/ addge ne: 41394 ; RRID:Addgene_41394)], pLX301 [a gift from David Root (Addgene plasmid #25895; http:// n2t. net/ addge ne: 25895 ; RRID:Addgene_25895)32], and Article Title: Mis-splicing-derived neoantigens and cognate TCRs in splicing factor mutant leukemias. Article Snippet: Four to six-week-old male and female NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG)mice were purchased from Jackson Laboratory and housed in pathogen-free conditions at the MSKCC vivarium. .. HLA-A*02:01 cDNA plasmid was provided by Taha Merghoub. pENTR223 CD80 (clone ID: 515155) and pENTR223 CD83 (clone ID: 506972) were purchased from DNASU and cloned into Article Title: DeSUMOylating isopeptidase 1 participates in the faithful chromosome segregation and vincristine sensitivity Article Snippet: To construct pENTR4‐no‐ccDB‐FLAG‐SENP1, a SENP1 fragment harboring SalI–XbaI sites, amplified with primers (5′‐AAAGTCGACACCATGGACTACAAAGACGATGACGACAAGC‐3′ and 5′‐AAATCTAGATCACAAGAGTTTTCGGTGGAGGATCTCCC‐3′) using the Flag‐SENP1 [a gift from Edward Yeh (Addgene plasmid #17357; http://n2t.net/addgene:17357 ; RRID:Addgene_17357) ], was ligated into the SalI–XbaI sites of the pENTR4‐no‐ccDB. .. The genes in the entry vectors were subcloned into the gateway destination vectors, pLIX402 [a gift from David Root (Addgene plasmid #41394; http://n2t.net/addgene:41394 ; RRID:Addgene_41394)], pLX301 [a gift from David Root (Addgene plasmid #25895; http://n2t.net/addgene:25895 ; RRID:Addgene_25895) ], and Article Title: De novo identification of the specificities of recurrently identified human T cell receptors Article Snippet: HeLa and 293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% FBS. .. Self-inactivating minimal HIV-1 virus was produced in 293T cells using the vectors pLX301 or Construct:Article Title: SUMO-activated target traps (SATTs) enable the identification of a comprehensive E3-specific SUMO proteome Article Snippet: Stable-inducible GFP-LAZSUL construct was generated by LR gateway cloning between pDNOR207-GFP-ZNF451-3 and pCW57.1 (Addgene, #41393). .. NSMCE2-rescued constructs were generated by LR between either pENTR223-NSMCE2-WT or pENTR223-NSMCE2 C185S-H187A and Article Title: SUMO-activated target traps (SATTs) enable the identification of a comprehensive E3-specific SUMO proteome. Article Snippet: Stable-inducible GFP-LAZSUL construct was generated by LR gateway cloning between pDNOR207-GFP-ZNF451-3 and pCW57.1 (Addgene, #41393). .. NSMCE2-rescued constructs were generated by LR between either pENTR223-NSMCE2-WT or pENTR223-NSMCE2C185S-H187A and Article Title: De novo identification of the specificities of recurrently identified human T cell receptors Article Snippet: HeLa and 293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% FBS. .. Self-inactivating minimal HIV-1 virus was produced in 293T cells using the vectors pLX301 or Generated:Article Title: SUMO-activated target traps (SATTs) enable the identification of a comprehensive E3-specific SUMO proteome Article Snippet: Stable-inducible GFP-LAZSUL construct was generated by LR gateway cloning between pDNOR207-GFP-ZNF451-3 and pCW57.1 (Addgene, #41393). .. NSMCE2-rescued constructs were generated by LR between either pENTR223-NSMCE2-WT or pENTR223-NSMCE2 C185S-H187A and Article Title: SUMO-activated target traps (SATTs) enable the identification of a comprehensive E3-specific SUMO proteome. Article Snippet: Stable-inducible GFP-LAZSUL construct was generated by LR gateway cloning between pDNOR207-GFP-ZNF451-3 and pCW57.1 (Addgene, #41393). .. NSMCE2-rescued constructs were generated by LR between either pENTR223-NSMCE2-WT or pENTR223-NSMCE2C185S-H187A and other:Article Title: De novo identification of the specificities of recurrently identified human T cell receptors. Article Snippet: Jurkat cells were obtained from American Type Culture Collection and maintained in RPMI (Gibco) supplemented with 10% fetal bovine serum (FBS; Gemini Bio- Products) and penicillin- streptomycin (Gibco). Article Title: De novo identification of the specificities of recurrent human T cell receptors Article Snippet: HeLa and 293T cells were maintained in DMEM (Gibco) supplemented with 10% FBS. Clone Assay:Article Title: Mis-splicing-derived neoantigens and cognate TCRs in splicing factor mutant leukemias. Article Snippet: Four to six-week-old male and female NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG)mice were purchased from Jackson Laboratory and housed in pathogen-free conditions at the MSKCC vivarium. .. HLA-A*02:01 cDNA plasmid was provided by Taha Merghoub. pENTR223 CD80 (clone ID: 515155) and pENTR223 CD83 (clone ID: 506972) were purchased from DNASU and cloned into Virus:Article Title: De novo identification of the specificities of recurrently identified human T cell receptors Article Snippet: HeLa and 293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% FBS. .. Self-inactivating minimal HIV-1 virus was produced in 293T cells using the vectors pLX301 or Produced:Article Title: De novo identification of the specificities of recurrently identified human T cell receptors Article Snippet: HeLa and 293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% FBS. .. Self-inactivating minimal HIV-1 virus was produced in 293T cells using the vectors pLX301 or |